Try it yourself

This tutorial will walk you through an example. First, make sure you've read and followed along with the example in Design guide RNAs

Next, follow along here to design a homologous recombination donor template for the Brca2 gene in a human genome (hg38).

Choose your gRNA from your guide RNA design list. In this example, we will choose GAAACCATCTTATAATCAGC on Exon 3.

Click the CRISPR icon on the side panel, and then Create HR Template (SSODN).

Select the hg38 genome, and select Create a copy of this sequence.

Use the annotation tab to go to Exon 3, and make a point mutation at 32319199 from A to T, so that new 26th amino acid will be Threonine (T) instead of Serine (S), and click Next. The wizard will record these changes for you as well.

Tip: You can use ctrl/cmd + g to jump to a specific base pair.

Copy and annotate your guide in the new HR template for easy future reference.

Adjust the length of HR arms on both sides by dragging the highlighted sequence. For this example, we will leave the arm lengths at 100 bp for the left arm, and 99 bp for the right arm.

Copy your guide RNA (GAAACCATCTTATAATCAGC) into the Guide box. The table will show a list of possible silent mutations to change the target site in your HR template. To avoid the HR template being degraded by Cas9, it is most effective to mutate the PAM sequence. The wizard will automatically select a the best mutation for you.

Click Next, and you’ve now designed a HR template that is ready to be copied into your clipboard for de novo synthesis.

Read tips for HR template design

For more tips and tricks on HR template design, take a look at this blog post.

Did this answer your question?